Free. Exclusive. Just for you.
Four unique services that make learning easier, faster, and smarter - only on our website.

Biology worksheet focusing on RNA and protein synthesis, including tRNA, mRNA, and DNA sequences.

A worksheet with exercises on writing tRNA sequences from mRNA, translating amino acid sequences from tRNA, and transcribing DNA strands into tRNA sequences.

A worksheet with exercises on writing tRNA sequences from mRNA, translating amino acid sequences from tRNA, and transcribing DNA strands into tRNA sequences.

PNG 1000×1294 107.3 KB Free · Personal Use
Quality Assured by Worksheets Library Team
Reviewed for educational accuracy and age-appropriateness
ID: #497546
Show Answer Key & Explanations Step-by-step solution for: Free Collection of DNA Base Pairing Worksheets for Teaching

Problem Analysis


The task involves several steps related to molecular biology, including:
1. Writing the tRNA sequence for a given mRNA strand.
2. Translating codons into amino acids.
3. Transcribing a DNA strand into mRNA and then translating it into an amino acid sequence.

We will solve each part step by step.

---

Part 1: Writing the tRNA Sequence for the Given mRNA Strand



#### Problem 13: AGGUCAUGCAUGGGCAUGCAGU

- tRNA Function: tRNA molecules recognize specific codons on mRNA and bring the corresponding amino acids during translation. The anticodon on tRNA is complementary to the codon on mRNA.
- Anticodon Rules:
- The anticodon on tRNA pairs with the codon on mRNA using Watson-Crick base pairing rules: A-U, U-A, G-C, C-G.
- The anticodon is written in the reverse order of the codon (5' to 3') because tRNA binds to mRNA in the opposite direction.

#### Solution:
1. Identify the codons in the mRNA strand: `AGG UCA UGC AUG GGC AUG CAU`.
2. Write the complementary anticodons for each codon:
- `AGG` → `UCC`
- `UCA` → `AGA`
- `UGC` → `ACG`
- `AUG` → `UCA`
- `GGC` → `CCG`
- `AUG` → `UCA`
- `CAU` → `GUA`
3. Reverse the order of each anticodon to get the tRNA sequence:
- `UCC` → `CCU`
- `AGA` → `AGU`
- `ACG` → `CGU`
- `UCA` → `AUG`
- `CCG` → `GCC`
- `UCA` → `AUG`
- `GUA` → `AUC`

Thus, the tRNA sequence is:
Answer for Problem 13: CCU AGU CGU AUG GCC AUG AUC

---

Part 2: Translating Codons into Amino Acids



#### Problem 17: AUG CAC UGU CCU UUC GCU GAC

- Translation Rules: Each codon corresponds to a specific amino acid according to the genetic code. We use the standard genetic code table to translate each codon.

#### Solution:
1. Translate each codon:
- `AUG` → Methionine (Met)
- `CAC` → Histidine (His)
- `UGU` → Cysteine (Cys)
- `CCU` → Proline (Pro)
- `UUC` → Phenylalanine (Phe)
- `GCU` → Alanine (Ala)
- `GAC` → Aspartic Acid (Asp)

Thus, the amino acid sequence is:
Answer for Problem 17: Met His Cys Pro Phe Ala Asp

---

#### Problem 18: GAG AUC UGG UUG GAA UCG

1. Translate each codon:
- `GAG` → Glutamic Acid (Glu)
- `AUC` → Isoleucine (Ile)
- `UGG` → Tryptophan (Trp)
- `UUG` → Leucine (Leu)
- `GAA` → Glutamic Acid (Glu)
- `UCG` → Serine (Ser)

Thus, the amino acid sequence is:
Answer for Problem 18: Glu Ile Trp Leu Glu Ser

---

#### Problem 19: AGC GUA UUA ACG UAU CAU

1. Translate each codon:
- `AGC` → Serine (Ser)
- `GUA` → Valine (Val)
- `UUA` → Leucine (Leu)
- `ACG` → Threonine (Thr)
- `UAU` → Tyrosine (Tyr)
- `CAU` → Histidine (His)

Thus, the amino acid sequence is:
Answer for Problem 19: Ser Val Leu Thr Tyr His

---

#### Problem 20: AGU CGA UCG AUG CGG AUG AUA

1. Translate each codon:
- `AGU` → Serine (Ser)
- `CGA` → Arginine (Arg)
- `UCG` → Serine (Ser)
- `AUG` → Methionine (Met)
- `CGG` → Arginine (Arg)
- `AUG` → Methionine (Met)
- `AUA` → Isoleucine (Ile)

Thus, the amino acid sequence is:
Answer for Problem 20: Ser Arg Ser Met Arg Met Ile

---

#### Problem 21: GUC GUC GAU AGC UAU GCA

1. Translate each codon:
- `GUC` → Valine (Val)
- `GUC` → Valine (Val)
- `GAU` → Aspartic Acid (Asp)
- `AGC` → Serine (Ser)
- `UAU` → Tyrosine (Tyr)
- `GCA` → Alanine (Ala)

Thus, the amino acid sequence is:
Answer for Problem 21: Val Val Asp Ser Tyr Ala

---

Part 3: Transcribing DNA into mRNA and Translating into Amino Acids



#### Problem 22: TGAGTCGACTGGCTGACC GTAGAC

1. Transcription: Convert DNA to mRNA by replacing T with U and keeping the other bases the same.
- DNA: `TGAGTCGACTGGCTGACCGTAGAC`
- mRNA: `UGAGUCGAUGGCGUGACCGUAGAC`

2. Translation: Break the mRNA into codons and translate each codon:
- mRNA: `UGA GUC GAU GGC GUG ACC GUAG AC`
- Codons: `UGA`, `GUC`, `GAU`, `GGC`, `GUG`, `ACC`, `GUA`, `GAC`
- Translation:
- `UGA` → Stop codon (translation terminates)
- `GUC` → Valine (Val)
- `GAU` → Aspartic Acid (Asp)
- `GGC` → Glycine (Gly)
- `GUG` → Valine (Val)
- `ACC` → Threonine (Thr)
- `GUA` → Valine (Val)
- `GAC` → Aspartic Acid (Asp)

Since the first codon is a stop codon (`UGA`), translation terminates immediately. Therefore, no amino acids are produced.

Thus, the amino acid sequence is:
Answer for Problem 22: (No amino acids produced)

---

#### Problem 23: CTTGGC TTATGG TGGTTC GCTCGC

1. Transcription: Convert DNA to mRNA by replacing T with U and keeping the other bases the same.
- DNA: `CTTGGCTTATGGTGGTTTCGCTCGC`
- mRNA: `UAGGCCAAUGGACCAAAGCGAGCG`

2. Translation: Break the mRNA into codons and translate each codon:
- mRNA: `UAG GCC AAU GGA CCA AAG CGA GCG`
- Codons: `UAG`, `GCC`, `AAU`, `GGA`, `CCA`, `AAG`, `CGA`, `GCG`
- Translation:
- `UAG` → Stop codon (translation terminates)
- `GCC` → Alanine (Ala)
- `AAU` → Asparagine (Asn)
- `GGA` → Glycine (Gly)
- `CCA` → Proline (Pro)
- `AAG` → Lysine (Lys)
- `CGA` → Arginine (Arg)
- `GCG` → Alanine (Ala)

Since the first codon is a stop codon (`UAG`), translation terminates immediately. Therefore, no amino acids are produced.

Thus, the amino acid sequence is:
Answer for Problem 23: (No amino acids produced)

---

Final Answers


1. Problem 13: CCU AGU CGU AUG GCC AUG AUC
2. Problem 17: Met His Cys Pro Phe Ala Asp
3. Problem 18: Glu Ile Trp Leu Glu Ser
4. Problem 19: Ser Val Leu Thr Tyr His
5. Problem 20: Ser Arg Ser Met Arg Met Ile
6. Problem 21: Val Val Asp Ser Tyr Ala
7. Problem 22: (No amino acids produced)
8. Problem 23: (No amino acids produced)

Boxed Final Answer:
\[
\boxed{
\begin{aligned}
&\text{13. } \text{CCU AGU CGU AUG GCC AUG AUC} \\
&\text{17. } \text{Met His Cys Pro Phe Ala Asp} \\
&\text{18. } \text{Glu Ile Trp Leu Glu Ser} \\
&\text{19. } \text{Ser Val Leu Thr Tyr His} \\
&\text{20. } \text{Ser Arg Ser Met Arg Met Ile} \\
&\text{21. } \text{Val Val Asp Ser Tyr Ala} \\
&\text{22. } \text{(No amino acids produced)} \\
&\text{23. } \text{(No amino acids produced)}
\end{aligned}
}
\]
Parent Tip: Review the logic above to help your child master the concept of base pairing worksheet.
Print Download

How to use

Click Print to open a print-ready version directly in your browser, or use Download to save the file to your device. The ⭐ Answer button generates an AI answer key instantly - useful for teachers who need a quick reference. Need a different version? Our AI Worksheet Generator lets you create a custom worksheet on any topic in seconds.

(view all base pairing worksheet)

Grade 9 Dna Base Pairing Worksheets 2024
Solved 1 of 4 DNA Base Pairing Worksheet There he performley ...
DNA/RNA Base Pairing Practice Worksheet
DNA Base Pairing Practice
DNA Base Pairing Worksheet - Laney Lee
Dna Base Pairing Worksheet | PDF | Genetic Code | Base Pair
Solved Write The Complementary DNA Strand For Each Given, 43% OFF
DNA Base Pairing Worksheet.docx - DNA Base Pairing Worksheet There ...
DNA Base Pairing Worksheet
Solved 1 of 4 DNA Base Pairing Worksheet There he performley ...