Free. Exclusive. Just for you.
Four unique services that make learning easier, faster, and smarter - only on our website.

How DNA is Copied: A step-by-step diagram showing the process of DNA replication, including unwinding, complementary base pairing, and formation of new DNA strands.

Diagram illustrating the process of DNA replication, showing steps such as unwinding of the double helix, addition of complementary nucleotides by DNA polymerase, and formation of two new identical DNA molecules.

Diagram illustrating the process of DNA replication, showing steps such as unwinding of the double helix, addition of complementary nucleotides by DNA polymerase, and formation of two new identical DNA molecules.

PNG 558×737 33.8 KB Free · Personal Use
Quality Assured by Worksheets Library Team
Reviewed for educational accuracy and age-appropriateness
ID: #773333
Show Answer Key & Explanations Step-by-step solution for: Unravelling the Mystery of DNA With The Best 10 DNA Replication ...
4. It means that the sequence of nucleotides in one strand determines the sequence in the other strand through specific base pairing (A with T, G with C), allowing each strand to serve as a template for the other.

5. DNA replication is the biological process by which a cell makes an identical copy of its DNA before cell division, ensuring each daughter cell receives a complete set of genetic instructions.

6.
b. The DNA double helix breaks or unzips down the middle between the base pairs.
c. A complementary strand is created for each of the two strands of the original double helix.
a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand.
d. Two new identical DNA molecules have been produced.

7. True

8. False

9. False

10. In the nucleus of eukaryotic cells (or in the cytoplasm of prokaryotic cells).

11. During the S phase (synthesis phase) of the cell cycle, before cell division.

12.
Original Strand: ATGCAAATTGCTCACCGGGGATCAGCACCGG
Complementary Strand: TACGTTTAACGAGTGGCCCC TAGTCGTGGCC

Original Strand: AGGGGATCAGCACC CGGATTTCTATGAGCCTA
Complementary Strand: TCCCCTAGTCGTGGGCCTAAA GATACTCGGAT

Original Strand: AAGTACGATCGATGCACATGCATGCTCATCGC
Complementary Strand: TTCATGCTAGCTACGTGTACGTACGAGTAGCG

When a cell copies a DNA molecule:
1. DNA is unzipped, by helicase
2. The complementary bases are added to each template strand, by DNA polymerase
3. The 2 new strands are proofread for errors, by DNA polymerase and then DNA winds up.
Parent Tip: Review the logic above to help your child master the concept of dna replication activity worksheet.
Print Download

How to use

Click Print to open a print-ready version directly in your browser, or use Download to save the file to your device. The ⭐ Answer button generates an AI answer key instantly - useful for teachers who need a quick reference. Need a different version? Our AI Worksheet Generator lets you create a custom worksheet on any topic in seconds.

(view all dna replication activity worksheet)

DNA Transcription and Translation Labeling - Drag and Drop
Solved Pcriod Date AZ DNA Replication Practice Directions: | Chegg.com
Dna Replication Practice Worksheet: Complete with ease | airSlate ...
Label the Structures and Steps Involved in DNA Replication ?
DNA Replication online exercise for | Live Worksheets
DNA Replication Worksheet | Exercises Genetics | Docsity
Dna Replication Worksheets Reviewed by Teachers
DNA Replication Worksheet 1 .pdf - Name: Period: DNA Replication ...
DNA Replication Worksheet PDF | PDF | Dna | Dna Replication
Solved DNA Replication Practice Worksheet S Phase: | Chegg.com