1. A mutation is any change in a DNA sequence.
2. Silent mutations are "silent" because they do not change the amino acid sequence of the protein, so they have no effect on the organism's phenotype.
3. A substitution mutation that completely stops translation is a nonsense mutation.
4. Insertions and deletions are called "frameshift mutations" because they shift the reading frame of the codons during translation, altering all subsequent amino acids.
5. Mutations will be passed on to future generations only if they occur in germ-line cells (sperm or egg cells), as these are the cells that contribute genetic material to offspring.
6. True/False: Not all mutations are bad. Some can be neutral or even beneficial, depending on the environment and context.
7. True/False: Mutations can be passed from parent to child only if they occur in the germ-line cells, not in somatic (body) cells.
8. Labeling:
- Substitution: One base is replaced by another.
- Insertion: One or more bases are added.
- Deletion: One or more bases are removed.
- Duplication: A segment of DNA is copied.
- Inversion: A segment of DNA is reversed.
- Translocation: A segment of DNA is moved to a different chromosome.
9. Matching:
- 1. Mutation: A change in the DNA sequence.
- 2. Mitosis: The process of cell division that results in two identical daughter cells.
- 3. Crossing Over: The exchange of genetic material between homologous chromosomes during meiosis.
- 4. Meiosis: The process of cell division that results in four gametes with half the number of chromosomes.
- 5. Nucleotide: The building block of DNA and RNA.
- 6. Missense Mutation: A point mutation that changes one amino acid to another.
- 7. Amino Acid: The building block of proteins.
- 8. Codon: A sequence of three nucleotides that codes for an amino acid.
- 9. Gene: A segment of DNA that codes for a specific protein.
- 10. Non-disjunction: The failure of chromosomes to separate properly during cell division.
- 11. Gene Mutation: A change in the DNA sequence of a gene.
- 12. Insertion: The addition of one or more nucleotides into a DNA sequence.
- 13. Substitution: The replacement of one nucleotide with another.
- 14. Deletion: The removal of one or more nucleotides from a DNA sequence.
- 15. Silent Mutation: A point mutation that does not change the amino acid sequence.
- 16. Meiosis: The process of cell division that results in four gametes with half the number of chromosomes.
- 17. Chromosome: A structure made of DNA and proteins that contains genes.
- 18. Mutation: A change in the DNA sequence.
- 19. Nonsense Mutation: A point mutation that creates a premature stop codon.
- 20. Frameshift Mutation: An insertion or deletion that shifts the reading frame.
- 21. Inversion: A chromosomal mutation where a segment is reversed.
- 22. Duplication: A chromosomal mutation where a segment is copied.
- 23. Translocation: A chromosomal mutation where a segment is moved to a different chromosome.
- 24. Variation: Differences in traits among individuals of a species.
- 25. Disorder: A condition that affects the normal functioning of an organism.
10. Comparison:
- Original DNA: ATGCATCTAGGCA
- mRNA: UACGUAGAUCCGU
- Amino Acids: Tyr-Val-Asp-Pro
- Mutation #1: Inversion (TACGATCTAGGCA → mRNA: AUGCUAGAUCCGU → Met-Leu-Asp-Pro) → Missense Mutation
- Mutation #2: Deletion (ATGCATCTAGGCA → ATGCATCTAGGC → mRNA: UACGUAGAUCCG → Tyr-Val-Asp-Pro) → Silent Mutation (if the last codon is incomplete, it may be a frameshift)
- Mutation #3: Duplication (ATGCATCTAGGCA → ATGCATCTAGGCAATGCATCTAGGCA → mRNA: UACGUAGAUCCGUACGUAGAUCCGU → Tyr-Val-Asp-Pro-Tyr-Val-Asp-Pro) → Duplication
- Mutation #4: Translocation (ATGCATCTAGGCA → ATGTTAAGGCAT → mRNA: UACAAUUCGUAU → Tyr-Asn-Ser-Tyr) → Translocation
Parent Tip: Review the logic above to help your child master the concept of dna mutations worksheet.
