Educational worksheet on DNA replication, featuring questions, fill-in-the-blank exercises, and a diagram showing the unwinding and copying of DNA strands.

Problem Analysis:

The image contains a series of questions and tasks related to DNA replication. Below, I will solve each part step by step and explain the solution.

---

#### Question 4: What does it mean that the two strands of DNA are complementary?
- Explanation: In DNA, the two strands are complementary because they follow specific base-pairing rules: Adenine (A) pairs with Thymine (T), and Cytosine (C) pairs with Guanine (G). This means that the sequence of one strand determines the sequence of the other strand.
- Answer: The two strands of DNA are complementary because they follow the base-pairing rules: A pairs with T, and C pairs with G. Due to this base pairing, the information in one strand is mirrored in the other strand.

---

#### Question 5: What is DNA replication?
- Explanation: DNA replication is the process by which a cell duplicates its DNA before cell division. This ensures that each new cell receives an identical copy of the genetic material.
- Answer: DNA replication is the copying process that duplicates DNA, ensuring that the resulting cells have the same sets of DNA.

---

#### Question 6: Place the steps of DNA replication in the correct order.
The given steps are:
1. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each existing strand.
2. The DNA double helix breaks or unzips down the middle between the two pairs.
3. A complementary strand is created for each of the two strands of the original double helix.
4. Two new identical DNA molecules have been produced.

- Correct Order:
1. The DNA double helix breaks or unzips down the middle between the two pairs.
2. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each existing strand.
3. A complementary strand is created for each of the two strands of the original double helix.
4. Two new identical DNA molecules have been produced.

- Answer: The correct order is 2 → 1 → 3 → 4.

---

#### True/False Questions:

##### Question 7: The process of DNA replication results in a copy of the original DNA molecule.
- Explanation: DNA replication produces two identical copies of the original DNA molecule. Each new DNA molecule consists of one old strand and one newly synthesized strand (semi-conservative replication).
- Answer: True

##### Question 8: DNA does not have to break apart to be copied.
- Explanation: During DNA replication, the double helix must unwind and "unzip" to expose the individual strands so that new complementary strands can be synthesized. Therefore, DNA does break apart temporarily.
- Answer: False

##### Question 9: After DNA replication is complete, there are two new DNA molecules; one molecule has both of the original strands and one molecule has two new strands of DNA.
- Explanation: After DNA replication, each new DNA molecule consists of one original strand and one newly synthesized strand. Both new molecules are identical to the original DNA molecule.
- Answer: False

---

#### Question 10: Where does DNA replication happen?
- Explanation: DNA replication occurs in the nucleus of eukaryotic cells, where the DNA is stored. In prokaryotic cells, it occurs in the cytoplasm since prokaryotes do not have a nucleus.
- Answer: DNA replication happens in the nucleus.

---

#### Question 11: When does DNA replication happen?
- Explanation: DNA replication occurs during the S phase (synthesis phase) of the cell cycle. This is when the cell duplicates its DNA in preparation for cell division.
- Answer: DNA replication happens during the S phase.

---

#### Question 12: Below are DNA strands. Make the complementary DNA strand.

##### Part 1: Original Strand: ATGCCAAATTTGCTCACCGGGGATCAGCACCCGG
- Complementary Strand: To find the complementary strand, replace each base with its complement (A ↔ T, C ↔ G):
- A → T
- T → A
- G → C
- C → G
- Result: TACGGTTTAAACGAGTGCCCCATGTGCAGGGCC

##### Part 2: Original Strand: AGGGGATCAGGCACCAGGATTTCATGAGCCCCTA
- Complementary Strand:
- A → T
- T → A
- G → C
- C → G
- Result: TCCCCTAGTCGTTGGCTAAAATACTCGGGGAT

##### Part 3: Original Strand: AAGTACGATCGATGCACATGCA TGCGTACGTGTACGTACCGGATAGG
- Complementary Strand:
- A → T
- T → A
- G → C
- C → G
- Result: TTCATGCTAGCTAGCGTACGCA CGACATGACACATGGCTACCATT

---

#### Final Answer Box:
\[
\boxed{2 \rightarrow 1 \rightarrow 3 \rightarrow 4}
\]