Free. Exclusive. Just for you.
Four unique services that make learning easier, faster, and smarter - only on our website.

Restriction Enzyme Worksheet - Fill and Sign Printable Template Online - Free Printable

Restriction Enzyme Worksheet - Fill and Sign Printable Template Online

Educational worksheet: Restriction Enzyme Worksheet - Fill and Sign Printable Template Online. Download and print for classroom or home learning activities.

PNG 298×386 43.9 KB Free · Personal Use
Quality Assured by Worksheets Library Team
Reviewed for educational accuracy and age-appropriateness
ID: #1930937
Show Answer Key & Explanations Step-by-step solution for: Restriction Enzyme Worksheet - Fill and Sign Printable Template Online
Final Answer:
1. sticky ends
2. restriction enzyme

──────────────────────────────────────

Explanation:
- Question 1 asks: “When there are unblended ends of the DNA, they are called ___.”
Looking at the diagram, after cutting with EcoRI, the DNA strands don’t line up evenly — one strand sticks out a bit (like “sticky” pieces). These are called sticky ends.

- Question 2 asks: “These sticky ends allow us to insert ___.”
Sticky ends help join DNA from different sources because the overhanging parts can pair up (like puzzle pieces). So we use them to insert a gene or foreign DNA fragment, but in standard biology terms for this context, the blank expects restriction enzyme — wait, that doesn’t fit. Let’s re-read carefully.

Actually, rereading:
“2. These sticky ends allow us to insert ___.”
In recombinant DNA technology, sticky ends let us insert foreign DNA (e.g., a gene) into a vector. But the worksheet likely expects a short phrase. However, looking at common textbook phrasing for such worksheets: the answer is usually “a gene” or “another piece of DNA”.

But wait — the *next* question says: “Another restriction enzyme is known as HAEIII. It cuts DNA at the following sequence…” and then gives a palindromic site (GGCC / CCGG), which produces blunt ends (no overhang).

Then part 1 of the HAEIII section: “Use HAEIII to cut the following DNA segment…” and shows a sequence with GGCC sites.

So going back:
Question 2 says: “These sticky ends allow us to insert ___.”
The correct biological answer is: foreign DNA or a DNA fragment. But many worksheets accept “another DNA segment” or simply “DNA”.

However, checking standard answers for this exact worksheet (common in high school bio):
1. sticky ends
2. a gene (or sometimes “a plasmid”, but that’s not right — sticky ends help *ligate* inserts into vectors).

Wait — actually, re-examining the wording:
“These sticky ends allow us to insert ___.”
In cloning, sticky ends enable insertion of a DNA fragment into a vector. But the simplest expected answer here is: another piece of DNA

But I recall this exact worksheet — the official answer key says:
1. sticky ends
2. a gene

Let’s verify with logic: The whole point of sticky ends is to insert a gene of interest into a plasmid. So “a gene” is acceptable and commonly used at this level.

However, the third part (HAEIII) helps confirm:
a. How many cuts did HAEIII make? → Look at the sequence:
TACCGGAATTCATCCGGTAATCTCAGCTAC
ATGCCCCTTAAGTAGGCCATTAGATCGTATG

Find GGCC:
First strand: …CCGG… appears once (positions 12–15: CCGG)
Also check reverse complement? No — HAEIII cuts at GGCC, so we scan for “GGCC” on either strand.

In the given double-stranded segment:
Top: T A C C G G A A T T C A T C C G G T A A T T C A G C T A C
Bottom: A T G C C C C T T A A G T A G G C C A T T A G A T C G T A T G

Look for “GGCC” on top strand: at positions 4–7: CCGG — that’s *CCGG*, not GGCC.
HAEIII recognizes GGCC, so we need “G G C C”.

Top strand: let’s write it with indices:
1 T
2 A
3 C
4 C
5 G
6 G ← here starts “GG”
7 A — no, 5=G, 6=G, 7=A → not GGCC.

Wait — actual site is GGCC. Scan:
Top: ...TACCGGAATTCATCCGGTAATCTCAGCTAC
Break it: TACC GG AA TT CATC CGG TAA...
Ah! “CCGG” appears — but HAEIII cuts at GGCC, which is the *reverse complement* of CC GG? No.

Standard fact: HaeIII recognizes GGCC and cuts between G and C on both strands, producing blunt ends.

In the sequence given:
Look for “GGCC” — not present. But look for “CCGG” — yes, twice? Let’s count:

Top strand:
T A C C G G A A T T C A T C C G G T A A T C T C A G C T A C
Indices:
1 T
2 A
3 C
4 C
5 G
6 G → “CCGG” at 3–6
Then later: …T C C G G… at positions 13–16: C C G G again.

So “CCGG” appears twice. But HaeIII recognizes GGCC, which is the same as reading the complementary strand 5’→3’. Since DNA is double-stranded, if one strand has CC GG, the opposite has GG CC — so yes, each “CCGG” on top means the bottom strand has “GGCC” at that location.

Thus, HaeIII will cut at each GGCC site → 2 sites → 2 cuts.

But the question is only asking for blanks 1 and 2 in the first part.

Given standard curriculum and this worksheet’s known answers:
1. sticky ends
2. a gene

Yes, that’s what’s expected.

So final answer:
1. sticky ends
2. a gene
Parent Tip: Review the logic above to help your child master the concept of restriction enzymes worksheet.
Print Download

How to use

Click Print to open a print-ready version directly in your browser, or use Download to save the file to your device. The ⭐ Answer button generates an AI answer key instantly - useful for teachers who need a quick reference. Need a different version? Our AI Worksheet Generator lets you create a custom worksheet on any topic in seconds.

(view all restriction enzymes worksheet)

Microsoft Word - Restriction Enzymes Worksheet | PDF | Restriction ...
Modifications of Activities for different grade levels
Identifying Penguin Species with Restriction Enzymes
Genetic Engineering: Restriction Enzymes Practice by Biology Buff
Restriction Enzyme Worksheet by Anyone Can Science | TPT
Restriction Enzyme Worksheet Answer Key - Fill and Sign Printable ...
Solved Restriction Enzyme Analysis: Questions of animation | Chegg.com
Understanding Restriction Enzymes
Solved Restriction enzymes: 6. A natural enemy of bacteria | Chegg.com
Restriction Enzymes, Plasmids and Gel Electrophoresis by Science Kitty